Solid-phase synthesis of positively charged deoxynucleic guanidine (DNG) tethering a Hoechst 33258 analogue: triplex and duplex stabilization by simultaneous minor groove binding.
نویسندگان
چکیده
Deoxynucleic guanidine (DNG), a DNA analogue in which positively charged guanidine replaces the phosphodiester linkages, tethering to Hoechst 33258 fluorophore by varying lengths has been synthesized. A pentameric thymidine DNG was synthesized on solid phase in the 3' --> 5' direction that allowed stepwise incorporation of straight chain amino acid linkers and a bis-benzimidazole (Hoechst 33258) ligand at the 5'-terminus using PyBOP/HOBt chemistry. The stability of (DNA)(2).DNG-H triplexes and DNA.DNG-H duplexes formed by DNG and DNG-Hoechst 33258 (DNG-H) conjugates with 30-mer double-strand (ds) DNA, d(CGCCGCGCGCGCGAAAAACCCGGCGCGCGC)/d(GCGGCGCGCGCGCTTTTTGGGCCGCGCGCG), and single-strand (ss) DNA, 5'-CGCCGCGCGCGCGAAAAACCCGGCGCGCGC-3', respectively, has been evaluated by thermal melting and fluorescence emission experiments. The presence of tethered Hoechst ligand in the 5'-terminus of the DNG enhances the (DNA)(2).DNG-H triplex stability by a DeltaT(m) of 13 degrees C. The fluorescence emission studies of (DNA)(2).DNG-H triplex complexes show that the DNG moiety of the conjugates bind in the major groove while the Hoechst ligand resides in the A:T rich minor groove of dsDNA. A single G:C base pair mismatch in the target site decreases the (DNA)(2).DNG triplex stability by 11 degrees C, whereas (DNA)(2).DNG-H triplex stability was decreased by 23 degrees C. Inversion of A:T base pair into T:A base pair in the center of the binding site, which provides a mismatch selectively for DNG moiety, decreases the triplex stability by only 5-6 degrees C. Upon hybridization of DNG-Hoechst conjugates with the 30-mer ssDNA, the DNA.DNG-H duplex exhibited significant increase in the fluorescence emission due to the binding of the tethered Hoechst ligand in the generated DNA.DNG minor groove, and the duplex stability was enhanced by DeltaT(m) of 7 degrees C. The stability of (DNA)(2).DNG triplexes and DNA.DNG duplexes is independent of pH, whereas the stability of (DNA)(2).DNG-H triplexes decreases with increase in pH.
منابع مشابه
Solid-phase synthesis of oligopurine deoxynucleic guanidine (DNG) and analysis of binding with DNA oligomers.
The first stepwise solid-phase synthesis of deoxynucleic guanidine (DNG), a positively charged DNA analog, using controlled pore glass as the solid support is reported. For the first time, purine bases have been incorporated into the DNG oligomer and DNG has been synthesized using a solid-phase method, proceeding in the 3'-->5' direction, that is compatible with the cleavage conditions used in ...
متن کاملDeoxynucleic Guanidine/Peptide Nucleic Acid Chimeras: Synthesis, Binding and Invasion Studies with DNA
A fully automated solid-phase synthetic procedure for incorporation of positively charged guanidinium linkages into otherwise neutral PNA sequences has been employed. These DNG/PNA chimeras form [(DNG/ PNA)2‚DNA] triplexes upon binding to single strand or duplex DNA (with accompanying D-loop for the latter). The [(DNG/PNA)2‚DNA] triplexes of DNG/PNA T10, with DNA dA10, are more stable than DNA‚...
متن کاملSolid-Phase Synthesis of Deoxynucleic Guanidine (DNG) Oligomers and Melting Point and Circular Dichroism Analysis of Binding Fidelity of Octameric Thymidyl Oligomers with DNA Oligomers
A practical solid-phase synthesis of deoxynucleic guanidine (DNG), a positively charged DNA backbone analogue, is reported. The nucleoside coupling step in the solid-phase synthesis of DNG involves the attack of a terminal 3′-amine upon an electronically activated 5′-carbodiimide to create a protected guanidinium internucleoside linkage. The activated carbodiimide is synthesized in situ by the ...
متن کاملReaching into the major groove of B-DNA: synthesis and nucleic acid binding of a neomycin-hoechst 33258 conjugate.
Synthesis of a neomycin-Hoechst 33258 conjugate is reported. The conjugate combines the ligands known to selectively bind in the duplex and the triplex groove. The conjugate stabilizes DNA duplex over DNA triplex. The conjugate selectively stabilizes the DNA duplex (in the presence of salt), with as little as 2 muM of the ligand leading to a DeltaTm of 25 degrees C.
متن کاملVariability in DNA minor groove width recognised by ligand binding: the crystal structure of a bis-benzimidazole compound bound to the DNA duplex d(CGCGAATTCGCG)2.
An analogue of the DNA-binding compound Hoechst 33258, in which the piperazine ring has been replaced by an imidazoline group, has been cocrystallized with the dodecanucleotide sequence d(CGCGAATTCGCG)2. The structure has been solved by X-ray diffraction analysis and has been refined to an R-factor of 19.7% at a resolution of 2.0 A. The ligand is found to bind in the minor groove, at the centra...
متن کاملذخیره در منابع من
با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید
برای دانلود متن کامل این مقاله و بیش از 32 میلیون مقاله دیگر ابتدا ثبت نام کنید
ثبت ناماگر عضو سایت هستید لطفا وارد حساب کاربری خود شوید
ورودعنوان ژورنال:
- Journal of the American Chemical Society
دوره 126 12 شماره
صفحات -
تاریخ انتشار 2004